-------------------------- Analysing coding sequences -------------------------- From an alignment ================= This section presents the tools allowing to compute diversity statistics from coding sequences or, more precisely, on specifically either synonymous or non-synonymous variation. The principle is to restrict the analysis of diversity to sites that can unambiguously be assigned to a synonymous or non-synonymous status, i.e. sites with only two alleles or sites where either all alleles code for the same amino acid (synonymous) or all alleles code for different amino acids (non-synonymous). This analysis must be performed at the level of coding sites, i.e. triplet of nucleotide sites in the coding region that encode an amino acid. Let's first assume that the :class:`.Align` object ``aln`` contains aligned sequences loaded from the Fasta file, i.e. associated to the standard DNA alphabet:: >>> aln = egglib.io.from_fasta_string("input file.fas", egglib.alphabets.DNA) In some cases, it is necessary to splice the alignment, in other words to extract the region or regions corresponding to the coding region. In this example there are two exons, representing 100 amino acids split into two exons of respectively 30 and 69 amino acids, one codon being sliced by the splicing site. The following code snippet extracts these two exons and converts the alignment from the DNA alphabet to an alphabet considering codons are single units:: >>> rf = egglib.tools.ReadingFrame([(139, 231), (451, 659)]) >>> cds = egglib.tools.to_codons(aln, frame=rf) The function :func:`~.tools.to_codons` transforms a DNA-encoded alignement to an alignment of codons (i.e. where each allele is one unit representing three consecutive bases). For convenience, the optional argument *frame* allows to process specific regions, here represented by an instance of the dedicated class :class:`~.tools.ReadingFrame`. The resulting object is still an :class:`.Align` but with a different alphabet designed for codons. Next, a class is dedicated to identify variable coding sites by separating synonymous and non-synonymous variation. This class is :class:`.stats.CodingDiversity`:: >>> cdiv = egglib.stats.CodingDiversity(cds) It takes an alignment of coding sequences using the codons alphabet, and provides several counters to access the number of analysed sites, the estimated number of non-synonymous and synonymous potential sites, and the actual (available number of variable non-synonymous and synonymous sites; see the class documentation for details). Variable sites that could be assigned to either status are available as attributes of the objects (``sites_NS`` and ``sites_S``), and these attributes can be passed to :class:`.stats.ComputeStats` for analysing diversity, using any available statistics:: >>> cs = egglib.stats.ComputeStats() >>> cs.add_stats('S', 'lseff', 'Pi', 'D') >>> statsS = cs.process_sites(cdiv.sites_S) >>> statsNS = cs.process_sites(cdiv.sites_NS) One should be aware that only variable sites are exported (obviously, fixed sites cannot be assigned to non-synonymous ou synonymous status). To express the statistics per site (and that's important since there are much more non-synonymous than synonymous sites), one should use the ``num_sites_S`` and ``num_sites_NS`` attributes of :class:`!CodingDiversity` objects for standardization. From a VCF file =============== If data are available in a VCF file, it is possible to use a class named :class:`.io.CodonVCF` to assign each site contained in the VCF to the non-synonymous or synonymous status. In the example below, we create two :class:`.stats.ComputeStats` objects to compute statistics separately on respectively synonymous and non-synonymous variation. The objects are configured to process multiple sites and to compute the same list of simple statistics:: >>> cs_syn = egglib.stats.ComputeStats(multi=True) >>> cs_syn.add_stats('Pi', 'D', 'lseff') >>> cs_nsyn = egglib.stats.ComputeStats(multi=True) >>> cs_nsyn.add_stats('Pi', 'D', 'lseff') Next we create the :class:`!CodonVCF` object, which requires the name of a VCF file and a GFF3 file providing the annotation:: >>> cdnVCF = egglib.io.CodonVCF('sequence5-example.bcf', 'sequence5-example.gff3') It is then necessary to specify which coding region (that is, the CDS feature) will be processed:: >>> cdnVCF.set_cds('CDS_1') After that, we can iterate over all codon positions of this coding region that are represented in the VCF file. The code below allows to exclude codons where more than one position is variable (according to the VCF file), and to analyse the site with the correct :class:`~ComputeStats` object according to its status:: >>> for cdn in cdnVCF.iter_codons(): ... if not cdn.flag & cdn.MMUT: ... if cdn.flag & cdn.SYN: cs_syn.process_site(cdn) ... if cdn.flag & cdn.NSYN: cs_nsyn.process_site(cdn) >>> print(cs_syn.results()) >>> print(cs_nsyn.results()) The object returned in the iteration is a specific type describing a coding site obtained from a VCF. It can be used as a site, in particular for computing statistics. It has also other members, such as ``flag`` which might not be easily intuitive but allows to perform a series of tests. The ``flag`` variable is a single integer that, if combined by the ``&`` operator to one of the pre-defined values ``MMUT``, ``SYN``, ``NSYN``, and others, allows to check if the current coding site has a given property. In this case, ``cdn.flag & cds.MMUT`` is ``True`` if the site has more than two alleles. The supported tests are listed in the reference manual. .. _group-labels: -------------------------- Structure and group labels -------------------------- Principle ========= Many statistics, including :math:`F_{ST}`, require that a structure is defined. In EggLib, the structure is controlled by instances of a specific class (:class:`.Structure`) that define groups and identify samples that belong to them. These structure objects define which samples belong to the outgroup and, how the other samples are organized in individuals and/or populations and/or clusters of populations. In this way, a three-level hierarchical structure can be defined. It is not required to provide information for all the three levels. The rationale of this system is to allow processing the same data set assuming different structurations (in order to either compare the effect of different ways to group samples, or analyze different subsets of the data separately). The approach is to keep the data set static, and provide a separate :class:`!Structure` instance holding the description of the structure for each analysis. There are four ways of creating a :class:`!Structure` instance. First, based on group labels of an :class:`.Align` instance. Second, based on group labels provided in a :class:`list` or another iterable. Third, by providing the sample size of each population. Fourth, from a more flexible explicit description of the structure as a :class:`dict` instance. Those approaches are described in the next paragraphs. Group labels ============ To account for structure, EggLib uses a specific system that consists in attaching labels to each samples. All samples bearing the same label are supposed to belong to the same group. There can be several labels per samples. We sometimes refer to an index among group labels as a *level*. Different levels of structure are aimed to represent either nested levels of structure (clusters of populations and/or populations and/or individuals) or alternative levels of structure. There are little restrictions on group labels besides being strings. All :class:`.Align` and :class:`.Container` instances have a list of labels attached to each sample. They can be set or edited using either :class:`.LabelView` which is a part of :class:`.SampleView` (see :ref:`proxy-types`) or direct class-level methods :meth:`~.Align.get_label` and :meth:`~.Align.set_label`. By default, this list of labels is empty. The aim of these group labels is essentially to be interpreted by the class :class:`!Structure` (actually through the method :meth:`.from_labels`) to be used for computing diversity statistics or restrict an operation to a given subgroup. In the following we explain how to specify group labels in Fasta files such as EggLib will properly interpret them and store them within an :class:`!Align` or :class:`!Container` instance. Group labels in Fasta files =========================== Single group label ****************** Let ``align2.fas`` be a Fasta file with six samples, the first three belonging to population "pop1" and the other three belonging to population "pop2". EggLib supports a specific system of tags within sequence headers in the Fasta format to indicate group labels. The tags must appear as suffix starting with a ``@`` followed by a string, as in the following example:: >sample1@pop1 ACCGTGGAGAGCGCGTTGCA >sample2@pop1 ACCGTGGAGAGCGCGTTGCA >sample3@pop1 ACCGTGGAGAGCGCGTTGCA >sample4@pop2 ACCGTGGAGAGCGCGTTGCA >sample5@pop2 ACCGTGGAGAGCGCGTTGCA >sample6@pop2 ACCGTGGAGAGCGCGTTGCA To import group labels, one is required to set the *labels* option of :func:`~.io.from_fasta` to ``True``:: >>> aln2 = egglib.io.from_fasta('align2.fas', alphabet=egglib.alphabets.DNA, labels=True) >>> print(aln2.get_name(0), aln2.get_label(0, 0)) sample1 1 If labels have not been imported, accessing any label will cause an error because, by default, there is no group labels at all included in :class:`!Align` instances:: >>> aln2 = egglib.io.from_fasta('align2.fas', alphabet=egglib.alphabets.DNA) >>> print(aln2.get_label(0, 0)) Traceback (most recent call last): File "", line 1, in File "/home/stephane/.local/lib/python3.9/site-packages/egglib/_interface.py", line 986, in get_label v = self._obj.get_label(self._sample(sample), self._label(index, self._sample(sample))) File "/home/stephane/.local/lib/python3.9/site-packages/egglib/_interface.py", line 827, in _label if index >= self._obj.get_nlabels(sample): raise IndexError('invalid label index') IndexError: invalid label index .. note:: :func:`.io.from_fasta` has an option (*label_marker*) to use a different character than ``@`` to separate the name and the tag. Multiple group labels ********************* There can be any number of group levels, either nested or not. To specify several labels for a sample, one can write several strings separated by commas, as in the following example:: >sam1@c1,i1 ACCGTGGAGAGCGCGTTGCA >sam2@c1,i1 ACCGTGGAGAGCGCGTTGCA >sam3@c1,i2 ACCGTGGAGAGCGCGTTGCA >sam1@c1,pop1,i1 ACCGTGGAGAGCGCGTTGCA >sam5@c2,pop1,i1 ACCGTGGAGAGCGCGTTGCA >sam6@c2,pop1,i2 ACCGTGGAGAGCGCGTTGCA The example above also demonstrate that it is possible to omit group labels for part of the samples, although it is probably better to avoid it (because it is error-prone). Labels absent for a given level are not added or initialised in any way. As a result, if the file shown above is saved as ``align3.fas`` we can access the second label of the first sample as shown in the highlighted line below: .. code-block:: python :emphasize-lines: 6 >>> aln3 = egglib.io.from_fasta('align3.fas', alphabet=egglib.alphabets.DNA, labels=True) >>> print(aln3.get_name(0)) sample1 >>> print(aln3.get_label(0, 0)) c1 >>> print(aln3.get_label(0, 1)) i1 So, at this point, one should understand labels as list of 0, 1 or more arbitrary identifiers attached to each sample. How this labels will be used to group samples in individuals, populations or possibly multi-level hierachical structure is up to the :class:`!Structure` class. .. note:: The separator can also be changed. This can be done using the *label_separator* argument of the :func:`.io.from_fasta` method. Outgroup specification ###################### Tools analysing diversity in EggLib can account for one or more outgroup samples. If individuals are defined in the main group (ingroup), it is required that outgroup samples also come as one or more individuals sharing the same ploidy. Individuals must be specified by the label ``#`` (obligatory as the only or first label), followed by maximum one other label (if the individual level is to be considered). Thus, outgroup samples are denoted by the tag ``@#`` or ``@#,IND`` where ``IND`` is an individual label. Note that if there are individuals in the ingroup then there must be also individuals in the outgroup (with the same ploidy). Very importantly, one must keep in mind that neither :func:`!io.from_fasta` nor :class:`!Align` have a notion of the outgroup. They don't interpret the ``#`` label as special and don't process outgroup samples differently of other samples. It will be the job of :class:`!Structure` to separate the outgroup from the rest of the samples. This means that, if you have outgroup samples including in your data, you *must* use a :class:`Structure` instance for treating them properly. Also, if you want to use another label than ``#`` to identify outgroup samples, you need to tell it to :class:`Structure`. Creating a structure from an alignment ====================================== To present the usage of the :class:`.Structure` class, we will use a complete, albeit over-simplified example. Consider the Fasta alignment below: .. code-block:: none >sample01@c1,p1,i01 CTTCCGGGAAGCGCCAGCAGAAGGTTGCTGCTAAGGCCCGCACACGTCTGCAGCACTTCG >sample02@c1,p1,i01 CTTCCGCGCAGGGCCAGGAGCATGTAGCTTCTAAGGCTTGCACAGGTCTTCAGCACTACG >sample03@c1,p1,i02 CTTCCGCGCAGGGCCAGGAGCATGTAGCTTCTAAGGCTTGCACAGGTCTTCAGCACTACG >sample04@c1,p1,i02 CTTCCGCGCAGGGCCAGGAGCATGTAGCTTCTAAGGCTTGCACAGGTCTTCAGCACTACG >sample05@c1,p1,i03 CTACCGTGACGAGCTAGCCGAGCCTGACGCAGGGGGCGAGTAAGGGAGATTACGACTTGG >sample06@c1,p1,i03 CTTCCGCGCAGGGCCAGGAGAATGTTGCTTCTAAGGCTTGCACAGGTCTTCAGCACTAAG >sample07@c1,p2,i04 CTGCTATGACGAACTACCCGAGCCTGGGGCATGGGGCGTGTATGGGAGCTTACAACTTGG >sample08@c1,p2,i04 CTTACGCGACGTGCCAGCATAGGGAAGCTGCTAAGGCCTGCACACGTCCGCAGCACTACG >sample09@c1,p2,i05 CTGCTATGACGAACTACCCGAGGCTGGGGCATGGGGCGTGTATGGGAGCTTACAACTTGG >sample10@c1,p2,i05 CTGCTATGACGAACTACCCGAGGCTGGGGCATGGGGCGTGTATGGGAGCTTACAACTTGG >sample11@c1,p2,i06 CTTACGCGACGCGCCAGCAGAGGGATGCTGCTAAGGCCTGCACACGTCCGCAGCACTACG >sample12@c1,p2,i06 CTTACGCGACGCGCCAGCAGAGGGATGCTGCTAAGGCCTGCACACGTCCGCAGCACTACG >sample13@c1,p2,i07 CTGCTATGACGAACTACCCGAGCCTGGGGCATGGGGCGTGTATGGGAGCTTACAACTTGG >sample14@c1,p2,i07 CTGCTATGACGAACTACCCGAGGCTGGGGCATGGGGCGTGTATGGGAGCTTACAACTTGG >sample15@c2,p3,i08 CTCCGGGGCCGGTTTCGCATAACGTCGCGCAGGGGACGTGTAGGGGCGCATACACCTGGG >sample16@c2,p3,i08 CTCCGGGGCCGGTTTCGCATAACGTCGCGCAGGGGACGTGTAGGGGCGCATACACCTGGG >sample17@c2,p3,i09 TTGCCGGGTCGAACTAGCCGACCTTGGCGCAGGGGTCGTTTAAGGGTCCTTACAACTTGG >sample18@c2,p3,i09 TTGCCGGGTCGAACTAGCCGACCTTGGCGCAGGGGTCGTTTAAGGGTCCTTACAACTTGG >sample19@c2,p3,i10 CTCCGGCGCCGGTTTCGCATAACGTCGCGCAGGGGACGTGTAGGGGCGCATACACCTGGG >sample20@c2,p3,i10 TTGCCGGGTCGAACTAGCCGACCTTGGCGAAGGGGTCGTTTAAGGGACCTTACAACTTGG >sample21@c2,p4,i11 TTGCCAGGACGAACTAGCCGCGCCTGGCGCAGGGGTCGTTTAAGGGAGCTTACAACTTGG >sample22@c2,p4,i11 TTGCCAGGACGAACTAGCCGCGCCTGGCGCAGGGGTCGTTTAAGGGAGCTTACAACTTGG >sample23@c2,p4,i12 TTGCCGGGACGAACTAGCCGAGCCTGGCGCAGGGGTCGTTTAAGGGAGCTTACAACTTGG >sample24@c2,p4,i12 TTGCCGGGACGAACTAGCCGAGCCTGGCGCAGGGGTCGTTTAAGGGAGCTTACAACTTGG >sample25@c2,p5,i13 CTACCGTGACGAACTAGCCGAGCCTGGCGCAGGGGGCGAGTAAGGGAGAGTACAACTTGG >sample26@c2,p5,i13 CTACCGTGACGAACTAGCCGAGCCTGGCGCAGGGGGCGAGTAAGGGAGAGTACAACTTGG >sample27@c2,p5,i14 CTACCGTGACGAACTAGCCGAGCCTGGCGCAGGGGGCGAGTAAGGGAGAGTACAACTTGG >sample28@c2,p5,i14 CTACCGTGACGAACTAGCCGAGCCTGGCGCAGGGGGCGAGTAAGGGAGAGTACAACTTGG >sample29@c2,p5,i15 TTGCCGCGACGAACTAGCCGAGCCTGGCGCAGGGGTCGTTTAAGGGAGCTAACAACTTGG >sample30@c2,p5,i15 CTACCGTGACGAACTAGCCGAGCCTGGCGCAGGGGGCGAGTAAGGGAGAGTACAACTTGG >sample31@#,i98 CATACCACCTTGGCCCGGAGAGTGCGGAGTACCGGGCGTGGAAGGCTGCATGCAAATGGA >sample32@#,i98 CATACCACCTTGGCCCGGAGAGTGCGGAGTACCGGGCGTGGAAGGCTGCATGCAAATGGA >sample33@#,i99 CATACCACCTTGGCCCGGAGAGAGCGCAGTGCCGGGCGTGGAAGGCTGCATTCAAATGCG >sample34@#,i99 CATACCACCTTGGCCCGGAGAGAGCGCAGTGCCGGGCGTGGAAGGCTGCATTCAAATGCG It has a total of 30 ingroup samples and 4 outgroup samples. These are actually respectively 15 and 2 individuals, and the ingroup is organized in two clusters of respectively two and three populations, themselves composed of two, three, or four individuals each. Remember the labels are arbitrary. In this case, cluster labels are ``c1`` and ``c2``, population labels ``p1`` to ``p5`` and individual labels ``i01`` to ``i15`` (``i98`` and ``i99`` for the two outgroup individuals). Let use name this file ``align5.fas`` and import it with group labels:: >>> aln = egglib.io.from_fasta('align5.fas', alphabet=egglib.alphabets.DNA, labels=True) Now, we will directly show a :class:`.Structure` instance incorporating all structure information (all three levels) can be created:: >>> struct = egglib.struct_from_labels(aln, lvl_clust=0, lvl_pop=1, lvl_indiv=2) >>> print(struct.as_dict()) ({'c2': {'p3': {'i09': [16, 17], 'i08': [14, 15], 'i10': [18, 19]}, 'p5': {'i13': [24, 25], 'i15': [28, 29], 'i14': [26, 27]}, 'p4': {'i11': [20, 21], 'i12': [22, 23]}}, 'c1': {'p1': {'i01': [0, 1], 'i03': [4, 5], 'i02': [2, 3]}, 'p2': {'i05': [8, 9], 'i04': [6, 7], 'i07': [12, 13], 'i06': [10, 11]}}}, {'i99': [32, 33], 'i98': [30, 31]}) We used the function :func:`.struct_from_labels` that generates a new :class:`!Structure` instance based on group labels of an :class:`!Align` (or :class:`!Container`). To use this method, it is necessary to tell which group level corresponds to the clusters, populations, and individuals in such a way that they are properly hierarchical. It is possible to skip any of these three levels of structure, simply by dropping the corresponding option parameter(s). The method :meth:`~.Structure.as_dict` is aimed to provide an intuitive representation of the structure held by the instance. In practice, it is as intuitive as possible while being flexible enough to represent all possible cases. .. _structure-dict: Dictionary representation of :class:`!Structure` instances ********************************************************** It is a :class:`tuple` containing two items, each being a :class:`dict`. The first one represents the ingroup and the second represents the outgroup. The ingroup dictionary is itself a dictionary holding more dictionaries, one for each cluster of populations. Each cluster dictionary is a dictionary of populations, populations being themselves represented by a dictionary. A population dictionary is, again, a dictionary of individuals. Finally individuals are represented by lists or integers. An individual list contains the index of all samples belonging to this individual. For haploid data, individuals will be one-item lists. In other cases, all individual lists are required to have the same number of items (consistent ploidy). Note that, if the ploidy is more than one, nothing enforces that samples of a given individual are grouped within the original data, meaning that you can shuffle labels in :class:`.Align` instances (or in your Fasta file) if you need to. The keys of the ingroup dictionary are the labels identifying each cluster. Within a cluster dictionary, the keys are population labels. Finally, within a population dictionary, the keys are individual labels. The second dictionary represents the outgroup. Its structure is simpler: it has individual labels as keys, and lists of corresponding sample indexes as values. The outgroup dictionary is similar to any ingroup population dictionary. The ploidy is required to match over all ingroup and outgroup individuals. If we go back to our example, we see that the returned dictionary for the ingroup has two items, with keys ``c1`` and ``c2``, respectively, and that the correct structure appears at lower levels, with two-item (diploid) individuals within populations withing clusters. Similarly, the two outgroup individuals, labelled ``i98`` and ``i99``, appear as expected in the second dictionary returned by the :meth:`!as_dict` method. Ultimately, the values contained by the lists are the lowest levels are the index referring to the original :class:`!Align` instance (from 0 to 29 in the ingroup, 30 to 33 in the outgroup). Alternative structure ********************* Occasionally, one will want to generate different :class:`!Structure` instances based on different levels of structure in group labels (for example if there are alternative structurations of the data). It is not required that all levels of a :class:`.Structure` instances are populated, and it is not necessary to import all structure levels of an :class:`.Align`. The example below demonstrates all this by importing the first level (previously, clusters) as populations in a new instance, skipping all other information:: >>> struct2 = egglib.struct_from_labels(aln, lvl_pop=0) >>> print(struct2.as_dict()) ({None: {'c2': {'24': [24], '25': [25], '23': [23], '27': [27], '15': [15],'14': [14], '17': [17], '16': [16], '19': [19], '18': [18], '22': [22], '28': [28], '26': [26], '29': [29], '20': [20], '21': [21]}, 'c1': {'11': [11], '10': [10], '13': [13], '12': [12], '1': [1], '0': [0], '3': [3], '2': [2], '5': [5], '4': [4], '7': [7], '6': [6], '9': [9], '8': [8]}}}, {'33': [33], '32': [32], '31': [31], '30': [30]}) Note that it is also possible to recycle an already existing :class:`!Structure` instance instead creating a new one (with the method :meth:`~.Structure.from_labels` of :class:`!Structure` instances.). Since we did not specify any group label index for the cluster level, there is no information regarding clusters, and all populations are placed in a single cluster. The default label is ``None`` in that case. The two labels ``c1`` and ``c2`` are now considered as population labels. At the lowest level (also in the outgroup), all samples are placed in a single-item individuals because, likewise, no index has been provided for the individual level. Then, haploidy is assumed, and the sample index is used as default value for individual labels (incremented in the outgroup). This example demonstrates that the group labels in :class:`!Align` instances have no particular meaning *per se* until they are interpreted while configuring a :class:`!Structure` instance. Passing labels directly ======================= Labels are not required to be included in a Fasta file. They can be passed as a :class:`!list` (or other iterable) of labels (or :class:`!list`/:class:`!tuple` of labels) to create a :class:`!structure` instance. This is done using the :func:`.struct_from_iterable` funtion. If a single label is passed, it is treated as a population label. If several labels are passed (as in the example below), the argument *fmt* must be used to specify the level represented by each column of the label table. The limitation is that this method doesn't allow to import ingroup. If the :class:`!Structure` instance created by the example below is used, samples corresponding to outgroups, which are not included in the :class:`!Structure`, will be ignored altogether (because :class:`!Structure` are not required to represent all samples of genetic data objects):: >>> labels = [ ... ('c1', 'p1', 'i01'), ... ('c1', 'p1', 'i01'), ... ('c1', 'p1', 'i02'), ... ('c1', 'p1', 'i02'), ... ('c1', 'p1', 'i03'), ... ('c1', 'p1', 'i03'), ... ('c1', 'p2', 'i04'), ... ('c1', 'p2', 'i04'), ... ('c1', 'p2', 'i05'), ... ('c1', 'p2', 'i05'), ... ('c1', 'p2', 'i06'), ... ('c1', 'p2', 'i06'), ... ('c1', 'p2', 'i07'), ... ('c1', 'p2', 'i07'), ... ('c2', 'p3', 'i08'), ... ('c2', 'p3', 'i08'), ... ('c2', 'p3', 'i09'), ... ('c2', 'p3', 'i09'), ... ('c2', 'p3', 'i10'), ... ('c2', 'p3', 'i10'), ... ('c2', 'p4', 'i11'), ... ('c2', 'p4', 'i11'), ... ('c2', 'p4', 'i12'), ... ('c2', 'p4', 'i12'), ... ('c2', 'p5', 'i13'), ... ('c2', 'p5', 'i13'), ... ('c2', 'p5', 'i14'), ... ('c2', 'p5', 'i14'), ... ('c2', 'p5', 'i15'), ... ('c2', 'p5', 'i15')] >>> struct = egglib.struct_from_iterable(labels, fmt='CPI') >>> print(struct.as_dict()) ({'c1': {'p1': {'i01': [0, 1], 'i02': [2, 3], 'i03': [4, 5]}, 'p2': {'i04': [6, 7], 'i05': [8, 9], 'i06': [10, 11], 'i07': [12, 13]}}, 'c2': {'p3': {'i08': [14, 15], 'i09': [16, 17], 'i10': [18, 19]}, 'p4': {'i11': [20, 21], 'i12': [22, 23]}, 'p5': {'i13': [24, 25], 'i14': [26, 27], 'i15': [28, 29]}}}, {}) Simple structure ================ If your data are organized in an intuitive way (that is, samples organized per individual and individuals grouped per population), and if the cluster level is not needed, you can use the function :func:`.struct_from_samplesizes`. This function takes a list of sample sizes (one item per population). For example, if your dataset contains two populations of 20 haploid individuals, you can enter simply:: >>> struct = egglib.struct_from_samplesizes([20, 20]) >>> print(struct.as_dict()) ({None: {'pop1': {'idv1': [0], 'idv2': [1], 'idv3': [2], 'idv4': [3], 'idv5': [4], 'idv6': [5], 'idv7': [6], 'idv8': [7], 'idv9': [8], 'idv10': [9], 'idv11': [10],'idv12': [11], 'idv13': [12], 'idv14': [13], 'idv15': [14], 'idv16': [15], 'idv17': [16], 'idv18': [17], 'idv19': [18], 'idv20': [19]}, 'pop2': {'idv21': [20], 'idv22': [21], 'idv23': [22], 'idv24': [23], 'idv25': [24], 'idv26': [25], 'idv27': [26], 'idv28': [27], 'idv29': [28], 'idv30': [29], 'idv31': [30], 'idv32': [31], 'idv33': [32], 'idv34': [33], 'idv35': [34], 'idv36': [35], 'idv37': [36], 'idv38': [37], 'idv39': [38], 'idv40': [39]}}}, {}) This function supports ploidy and outgroup individuals, so you can also declare, for example, two populations of 10 diploid individuals plus one outgroup individual:: >>> struct = egglib.struct_from_samplesizes([10, 10], ploidy=2, outgroup=1) >>> print(struct.as_dict()) ({None: {'pop1': {'idv1': [0, 1], 'idv2': [2, 3], 'idv3': [4, 5], 'idv4': [6, 7], 'idv5': [8, 9], 'idv6': [10, 11], 'idv7': [12, 13], 'idv8': [14, 15], 'idv9': [16, 17], 'idv10': [18, 19]}, 'pop2': {'idv11': [20, 21], 'idv12': [22, 23], 'idv13': [24, 25], 'idv14': [26, 27], 'idv15': [28, 29], 'idv16': [30, 31], 'idv17': [32, 33], 'idv18': [34, 35], 'idv19': [36, 37], 'idv20': [38, 39]}}}, {'idv21': [40, 41]}) Be careful that the order of samples in the :class:`!Align` or :class:`!Site` you'll be analyzing with the resulting :class:`!Structure` instance must be consistent. Populations must be grouped together in the order indicated (if sample sizes differ), as well as individuals in populations, and the outgroup must be at the end. Mapping individuals to populations ================================== The function :func:`.struct_from_mapping`, available since version 3.6, allows to create a :class:`.Structure` object using one or several :class:`dict` objects mapping individuals to populations and specify the number of alleles per individuals (i.e. the ploidy), assuming alleles are consecutive in the data. The list of names of individual, as they appear in the dataset, must be provided as the first argument of the function. The method is intended to be used describe structure of individuals from a VCF file (whatever the ploidy), as in the example below:: >>> vcf = egglib.io.VCF('data.bcf') >>> pops = {'pop1': ['sample1', 'sample2', 'sample3'], >>> ... 'pop2': ['sample4', 'sample5', 'sample6']} >>> struct = egglib.struct_from_mapping(vcf.get_samples(), pop=pops, diploid=2) Other options allow to specify an outgroup, a :class:`!dict` describing the organization of populations in clusters and, in the case where the provided names described alleles within individuals (in case a :class:`.Align` or :class:`.Site` is provided with ploidy > 1), a :class:`!dict` describing the organization of samples in individuals. Fully flexible dictionary ========================= It is possible to create a :class:`!Structure` instance from user-provided data formatted as dictionaries, using either the function :func:`.struct_from_dict` or the equivalent :meth:`method <.Structure.from_dict>` of :class:`!Structure` instances to recycle an existing instance. This approach allows maximal flexibility but requires that you create a properly formatted dictionary. Both methods take an *ingroup* and an *outgroup* argument, which are formatted exactly as the output of :meth:`!as_dict` (see :ref:`structure-dict`). This feature can be used to import complex structure information. Using the structure =================== Once a :class:`!Structure` has been configured to represent the structuration of the data set, it can be used as a descriptor while computing diversity statistics. This will make available a wide array of statistics requiring this type of information. For example, the statistics with codes ``Fis``, ``Gst``, ``WCist``, and ``WCisct`` require individual and/or population structure information and won't be computed if no structure is provided:: >>> cs = egglib.stats.ComputeStats() >>> cs.add_stats('Fis', 'FistWC', 'FisctWC', 'Gst') >>> print(cs.process_align(aln)) {'Gst': None, 'Fis': None, 'WCisct': None, 'WCist': None} To provide the :class:`!Structure` to :class:`.stats.ComputeStats`, one just needs to pass the instance as a value for the *struct* argument of the class constructor (or the :meth:`~.stats.ComputeStats.configure` method of :class:`!ComputeStats` instances or alternatively, their :meth:`~.ComputeStats.set_structure` method):: >>> cs.configure(struct=struct) >>> print(cs.process_align(aln)) {'FisctWC': (0.39885944313988575, 0.4964142771064885, 0.2339234438730581, 0.6972741981129913), 'Gst': 0.42684652746367224, 'Fis': 0.6361192023302706, 'FistWC': (0.39885944313988586, 0.4485871173702674, 0.6685233526761218)} The code above shows that, with proper structure, we can compute statistics taking into account the individual, population, and cluster levels. In particular, ``FisctWC`` takes all levels into account. In comparison, ``FistWC`` ignores the cluster level, but nothing prevents you from computing it at this point. The code below shows that we can analyse the same data with a different structure (using the second instance we created before, using the clusters as populations and ignoring other levels):: >>> cs.configure(struct=struct2) >>> print(cs.process_align(aln)) {'Fis': None, 'FistWC': None, 'Gst': 0.1987618106564927, 'FisctWC': None} Since the individual level is not available, the statistics ``Fis``, ``WCist``, and ``WCisct`` (which also requires the cluster level) cannot be computed. Only ``Gst`` can. It is still possible to call for statistics that cannot be computed, but their value will be set to ``None``. Phased individuals ================== Statistics are organized in groups. As its name suggests, the group ``+phased`` takes into account the phase of alleles when the ploidy is above 1. :class:`!ComputeStats` assumes that individuals are unphased, so alleles of each individual are collapsed in a single allele representing the genotype before computing statistics of this group. The example below demonstrates the problem: with 5 diploid individuals, all haplotypes being different, the number of haplotypes is 5 by default (5 different genotypes). If alleles are actually phased, we expect to find 10 unique haplotypes:: >>> aln = egglib.Align.create([ ... ('idv1/1', 'AAAAAAAAA'), ('idv1/2', 'AAAAAAAAC'), ... ('idv2/1', 'AAAAAAACC'), ('idv2/2', 'AAAAAACCC'), ... ('idv3/1', 'AAAAACCCC'), ('idv3/2', 'AAAACCCCC'), ... ('idv4/1', 'AAACCCCCC'), ('idv4/2', 'AACCCCCCC'), ... ('idv5/1', 'ACCCCCCCC'), ('idv5/2', 'CCCCCCCCC') ... ], egglib.alphabets.DNA) >>> struct = egglib.struct_from_samplesizes([5], ploidy=2) >>> cs = egglib.stats.ComputeStats(struct=struct) >>> cs.add_stats('Ki') >>> cs.process_align(aln) {'Ki': 5} To properly analyse phased data, one can either drop the individual level of the structure or, starting with version 3.6, use the *phased* argument:: >>> cs.set_structure(None) >>> cs.process_align(aln) {'Ki': 10} >>> cs.configure(struct=struct, phased=True) >>> cs.process_align(aln) {'Ki': 10}